Introduction
Pseudomonas syringae pv. phaseolicola infects bean (Phaseolus vulgaris L), P. syringae pv. actinidiae infects kiwi (Actinidia chinensis), and in strain CFBP3388 of P. syringae pv. syringae, isolated from vetch (Vicia sativa) produce a nonhost-specific, chlorosis inducing toxin known as phaseolotoxin (Mitchell, 1976; Tamura et al., 2002; Tourte & Manceau, 1995).
The production of this toxin is temperature dependent, being optimally produced between 18°C to 20°C, while no detectable amounts of phaseolotoxin are present above 28°C (Goss, 1940; Mitchell, 1978; Nuske & Fritsche, 1989). Phaseolotoxin is a reversible inhibitor of the enzymes ornithine carbamoyltransferase (OCTase; EC 2.1.3.3) (Ferguson, Johnston & Mitchell, 1980), which catalyzes the formation of citrulline from ornithine and carbamoylphosphate in the sixth step of the arginine biosynthetic pathway; and ornithine decarboxylase, which participates in the biosynthesis of polyamines (Bachmann, Matile & Slusarenko, 1998). P. syringae pv. phaseolicola is insensitive to the effect of its own toxin. The reason for this immunity was attributed to the presence of a phaseolotoxin-resistant OCTase (ROCT) activity in strains of P. syringae pv. phaseolicola capable of producing the toxin (Jahn, Sauerstein & Reuter, 1985; Mosqueda et al., 1990; Staskawicz, Panopoulo & Hoogenraad, 1980). The ROCT, is a polypeptide composed of 327 amino acid residues with a molecular mass of 36.52 kDa and is the product of the argK gene, which is expressed under conditions leading to the synthesis of phaseolotoxin, such as growth in minimal medium at 18°C (Hatziloukas & Panopoulos, 1992; Jahn, Sauerstein & Reuter, 1987; Mosqueda et al., 1990). The gene argK is necessary for P. syringae pv. phaseolicola under conditions of phaseolotoxin synthesis, because it ensures an optimal supply of the arginine required for its growth (López-López, Hernández-Flores, Cruz-Aguilar & Álvarez-Morales, 2004). There is evidence that argK is negatively regulated at 28°C by a repressor protein (Mosqueda et al., 1990). It was proposed that the repressor protein could binds to a specific DNA motifs (TRR; thermoregulatory region) found in the argK interpromoter region, which have been postulated to be involved in thermoregulation of phaseolotoxin synthesis (Rowley, Xu & Patil, 2000). Additionally, it has been shown that argK is not directly regulated by temperature, but most likely is regulated by a precursor of phaseolotoxin resembling carbamoylphosphate (López-López, Hernández-Flores, Cruz-Aguilar & Álvarez-Morales, 2004).
The genes required for the biosynthesis of phaseolotoxin are grouped in a genomic region that is called Pht cluster containing 23 genes included into a genomic region (Figure 1A) (Aguilera et al., 2007; Genka et al., 2006). These genes are organized in five transcriptional units, two monocistronic and three polycistronic, with one of them overlapping a larger operon (Aguilera et al., 2007).
Figure 1:
Promoter regions of the argK and phtABC genes. On top are depicted the Pht cluster of P. syringae pv. phaseolicola. The operons are named after the first gene of the operon. In the middle, nucleotide sequence of the argK-phtA intergenic region showing the -10 and -35 promoter sites for argK and for phtA are shown. The double-stranded sequence is shown to facilitate the identification of relevant sequences on both strands as the promoters are divergent. AT-rich sequences are underlined. In the bottom, amplicons and primers for KD0, KD1 and KD2 are depicted as bars. White bars represent the coding region of gene argK and black bars, represent the argK promoter and deletions. Northern blot probe is indicated as shaded bar above argK gene.
Recently, it was demonstrated that the coordinated participation of phtA, phtB and phtC products, coded into the Pht cluster, are necessary to carry out an efficient argK repression at temperatures not permissive for phaseolotoxin biosynthesis. Also, argK transcriptional control is mediated by a protein present in both, toxigenic and nontoxigenic strains of P. syringae and in Escherichia coli (Aguilera et al., 2012). The promoters for argK and phtABC genes have been previously determined and shown to be a Pribnow-type (σ70) promoters with appropriate -10 and -35 regions (Aguilera et al., 2007; Hatziloukas & Panopoulos, 1992). The promoter driving the expression of phtABC is divergent to the promoter of argK and both share an interpromoter region with distinct sequence features that suggest coordinate regulation (Aguilera et al., 2007). According to this, the aim of the present study was to evaluate the role of the interpromoter region on argK transcription in P. syringae pv. phaseolicola. To this end, we deleted this region and analyzed argK transcription in an heterologous system. Additionally, the effect of multiple copies of the region on phaseolotoxin production in strain NPS3121 was determined.
Materials and methods
Media and bacterial strains used in this work
The bacterial strains and plasmids used in this study are listed in Table I. E. coli DH5α was grown in Luria Bertani (LB) medium at 37°C. P. syringae pv. phaseolicola were routinely grown on King´s B medium (King, Ward & Raney, 1954). For phaseolotoxin production, P. syringae pv. phaseolicola was grown in M9 medium at 18°C during 48 h (Sambrook, Fritsch & Maniatis, 1989). P. syringae pv. phaseolicola NPS3121 and P. syringae pv. phaseolicola CYL233 are referred to as wild type strains. When required, carbenicillin was added at 100 (E. coli) or 300 (P. syringae) µg/ml final concentration. Primer sequences and targets are indicated in Table II and Figure 1B .
Table I:
Bacterial strains and plasmids.
| Strain or plasmid | Relevant characteristics | Reference or source |
|---|---|---|
| Bacterial strains | ||
| Escherichia coli | ||
| DH5α | supE44 ∆lacU169 (Φ80lacZ∆M15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Nalr | (Sambrook, Fritsch & Maniatis, 1989) |
| P. syringae pv. phaseolicola | ||
| NPS3121 | Wild type, Tox+ | (Peet, Lindgren, Willis & Panopoulos, 1986) |
| CYL233 | Wild type, Tox- | (Rico et al., 2003) |
| Plasmids | ||
| pUCP20 | Pseudomonas-E. coli shuttle vector; Apr; 3.89-kb; lacZ´ | (West, Schweizer, Dall, Sample & Runyen-Janecky, 1994) |
| pSAK | Apr; SAK in pUCP20 | (Aguilera et al., 2012) |
| pKD0 | Apr; KD0 in pUCP20 | This study |
| pKD1 | Apr; KD1 in pUCP20 | This study |
| pKD2 | Apr; KD2 in pUCP20 | This study |
Table II:
Primers used in this study.
| Amplicon | Primer Name | Primer sequence (5´→3´)a | Restriction enzimes | Reference |
|---|---|---|---|---|
| Northern blot | ||||
| argK | L10001 | CTTTGATGGTATGCATGCGGTT | (Aguilera et al., 2012) | |
| L10002 | GGAAGAACTGGCCAAACATTCG | (Aguilera et al., 2012) | ||
| Construction of plasmids | ||||
| KD0 | L100135 | CAATCCGAACTGCAGCCGAGACTAACGAAA | PstI | (Aguilera et al., 2012) |
| L100276 | GGGCAATGGATCCTTGACACGC | BamHI | This study | |
| KD1 | L100135 | CAATCCGAACTGCAGCCGAGACTAACGAAA | PstI | (Aguilera et al., 2012) |
| L100172 | CGACTACCCCGGGCCTGCACAAG | SmaI | This study | |
| KD2 | L100135 | CAATCCGAACTGCAGCCGAGACTA ACGAAA | PstI | (Aguilera et al., 2012) |
| L100170 | TGCAAAAACCCCCGGGCTACACTA ATG | SmaI | This study | |
Molecular biology techniques
Routine techniques were performed as described previously (Sambrook, Fritsch & Maniatis, 1989). Plasmids and DNA were purified from agarose gels with QIAGEN columns and kits (Valencia, Ca, USA). Chromosomal DNA from P. syringae pv. phaseolicola was obtained as described previously (Chen & Kuo, 1993). Restriction enzymes were used according to instructions provided by the suppliers. DNA fragments used as probes for Northern blots were labelled with [α-32P]dCTP using the Rediprime II Random Prime Labeling System (GE Healthcare, Buckinghamshire, UK).
Construction of plasmids containing argK promoter deletions
The genes phtABC and argK share an interpromoter region (149 bp) comprised among the -35 consensus sequences of each promoter (Figure 1A). Three versions of argK containing several interpromoter deletions (KD0, KD1 and KD2) were obtained by PCR using primers designed to include suitable restriction sites (Table II; Figure 1B). The KD0 amplicon was cloned into PstI-BamHI sites of the pUCP20 vector to create pKD0 plasmid. This amplicon contained 5 bp of the interpromoter region. The KD1 and KD2 amplicons were cloned into pUCP20 PstI-SmaI sites to create pKD1 and pKD2 plasmids. Both amplicons contained 35 bp and 78 bp of the interpromoter region, respectively. All constructions were confirmed by restriction patterns and electroporated into P. syringae pv. phaseolicola using a BioRad Gene Pulser (Hercules, Ca, USA) with the following parameters: 200 V, 20 Ω y 250 µFD.
RNA extraction and Northern blot analysis
The expression of argK was determined by Northern blot analysis. To that end, total RNA was extracted from cells by using TRIzol reagent as recommended by the manufacturer (Invitrogen, Carlsbad, Ca, USA) from cultures of P. syringae pv. phaseolicola grown in M9 medium at 18°C or 28°C until an O.D600 of 0.8. Genomic DNA was removed by digestion with TURBO DNA-free Kit (Invitrogen, Carlsbad, Ca, USA). Samples of total RNA (20 μg) were separated by electrophoresis using 1.3% denaturing agarose gels. The RNA was transferred to Hybond N+ nylon membranes (GE Healthcare, Buckinghamshire, UK) and cross-linked by exposure to UV radiation. Hybridization was performed using NorthernMax Prehybridization/Hybridization buffer (Ambion, Carlsbad, Ca, USA). A DNA probe (607 bp) for the argK gene was obtained using oligonucleotides previously reported (Table II). Hybridization was carried out overnight at 50°C. The membranes were washed twice with 2X SSC-0.1% sodium dodecyl sulfate (1X SSC is 0.15 M NaCl and 0.015 M sodium citrate) for 5 min at room temperature, followed by a wash with 1X SSC-0.1% sodium dodecyl sulfate for 3 min at 60°C. The membranes were exposed to a phosphorus screen and the signal detected in a Storm 860 apparatus (Molecular Dynamics, Sunnyvale, Ca, USA). The image analysis was made using ImageQuant version 1.1 (BioRad, Hercules, Ca, USA).
Phaseolotoxin bioassays
Phaseolotoxin production by P. syringae pv. phaseolicola NPS3121 was assayed by the E. coli growth inhibition assay as previously was described (Hernández-Guzmán & Álvarez-Morales, 2001). In every case, plates containing arginine were used as controls to confirm that growth inhibition was due to phaseolotoxin.
Results and discussion
Effect of deletions of the interpromoter region on argK transcription pattern in P. syringae pv. phaseolicola CYL233
To assess the effect of interpromoter region on argK transcription, we constructed plasmids with three deletions upstream -10 and -35 regions of the argK promoter (Figure 1A). Northern blot analysis were made to evaluate the expression of argK in an heterologous system. As a positive control expression, strain NPS3121 was used; as a negative control we used the strain CYL233(pUCP20), since strain CYL233 is a P. syringae pv. phaseolicola that does not produces phaseolotoxin because it lacks the Pht cluster (Rico et al., 2003). Also, we evaluated the transcript expression on strain CYL233(pSAK), which contains the complete interpromoter region.
Our work group has used the strain CYL233 to perform heterologous expression assays of genes from the Pht cluster in a genetic background similar to strain NPS3121. In those studies we have observed that in strain CYL233(pSAK), the introduced argK gene is expressed both 18°C and 28°C contrary to strain NPS3121wt in which argK is expressed only at 18°C (Aguilera et al., 2012; Aguilera et al., 2007). In this study, we also confirmed the expression of argK in CYL233(pSAK) at both temperatures in contrast with the expression at 18°C in the wild type strain NPS3121 (Figure 2). The plasmid pKD0 contains a 144 bp deletion affecting almost completely the interpromoter region, since only 5 bp remains upstream -35 region (Figure 1A). This deletion reduced the argK expression at 18°C compared with the strain CYL233(pSAK) containing the complete region at the same temperature.
Figure 2:
Effect of deletions of interpromoter region on the argK expression in P. syringae pv. phaseolicola. The expression of argK was evaluated by Northern blot in derivatives of strain CYL233 harboring plasmids with deletions as indicated above each blot. Blots were hybridized with an internal probe specific for argK, and the signal corresponding to the monocistronic argK RNA. Strain CYL233(pUCP20) was used as negative control of argK expression, whereas the wild type strain NPS3121 was used as a positive control. The numbers on top of the Northern blots represent the temperatures at which expression was assayed: 1 indicates 18°C and 2 indicates 28°C.
On the other hand, plasmids pKD1 and pKD2 carry part of the interpromoter sequence in which 114 bp and 71 bp were deleted, respectively. In both cases, we observed expression of argK only at 18°C, unlike the expression detected in CYL233(pSAK) at both temperatures. In all cases, argK expression is achieved without the need of any element coded by the Pht cluster, in agreement with previous reports (Aguilera et al., 2012).
For deletions encoded in plasmids pKD1 and pKD2, we observed that argK expression was a little stronger than that observed for the pKD0 plasmid (Figure 2), this may be due to the fact that pKD1 and pKD2 keep a bigger part of the interpromoter region than pKD0. It is important to note that no appreciable difference is observed among expression pattern for plasmids pKD1 and pKD2, suggesting that elimination of 71 bp of the interpromoter region is enough to promote the clearly diminish argK transcription and therefore, the sites within the 71 bp are necessary and sufficient for the efficient transcription of argK.
It was reported that argK and phtABC divergent promoters show AT-rich sites on both strands that could be implicated in polymerase binding (Aguilera et al., 2007). It is well known that in prokaryotes, RNA polymerase recognizes two consensus sequences in the promoter region sites, known as -10 and -35 boxes (Dombroski, Walter, Record, Siegele & Gross, 1992). These consensus sequences of argK promoter are conserved in plasmid pKD0, which allows some level of expression for argK, although less efficient when compared with the complete interpromoter region, at 18°C. It has been observed that in some promoters, AT-rich sequences are also recognized by the sigma subunit of the RNA polymerase (Ross et al., 1993). The efficiency between the promoter region and the RNA polymerase depends directly on variations in the consensus sequence, as well as the variations in the space among sequences (Dombroski, Walter, Record, Siegele & Gross, 1992). Based in the high affinity of the RNA polymerase for AT-rich sequences, we proposed that the AT-rich sequences located within interpromoter region (Figure 1A) could enhance the activity of the argK promoter, interacting with the C-terminus of the RNA polymerase sigma subunit.
It was interesting to note that in strain CYL233 containing the plasmids pKD0, pKD1 or pKD2, the transcription of argK at 28°C was abolished, in contrast with the expression observed in the same strain containing the plasmid pSAK (Figure 2). We believe that deleted fragments are important not only for argK transcription (as observed at 18°C), but also could be involved in the regulation mediated by temperature.
Effect of multiple copies of the interpromoter region on phaseolotoxin production
According to our results, we suggest that deleted fragments could be involved in argK thermoregulation. It has been proposed that in P. syringae pv. phaseolicola, the argK gene have TRR (thermoregulatory region) motifs which could be involved in its thermoregulation. Additionally, TRR motifs have been postulated to be involved in the control of phaseolotoxin synthesis (Rowley, Clements, Mandel, Humphreys & Patil, 1993; Rowley, Xu & Patil, 2000). In an effort to investigate more about these regions, we evaluated the effect of multiple copies of the interpromoter region on the phaseolotoxin production in P. syringae pv. phaseolicola strain NPS3121. To this, we obtained the strains NPS3121(pSAK) and NPS3121(pKD2), which contain both a chromosomal and the plasmids copies of argK and its regulatory sequences. The plasmid pKD2 occurs in multiple copies in a similar way to the plasmid pSAK (Aguilera et al., 2012).
As shown by the growth inhibition assay, the strains NPS3121(pSAK) and NPS3121(pKD2) produce phaseolotoxin at a level comparable to that of the wild type strain at 18°C. Unexpectedly, at 28°C, strain NPS3121(pSAK) was able to produce phaseolotoxin, (although at very low level) compared to wild type strain NPS3121 alone or harboring the plasmid pKD2 at the same temperature (Figure 3). It was reported that when TRR motifs, present in multiple copies, could override the thermoregulation of phaseolotoxin production by wild type cells at 28°C (Rowley, Clements, Mandel, Humphreys & Patil, 1993). In a similar way, we observed that the interpromoter region, in a multiple copies, also override the thermoregulation of phaseolotoxin at 28°C. At the moment we do not have a satisfactory explanation about the phaseolotoxin production in strain NPS3121(pSAK) at 28°C, however is plausible that sequences resembling TRR motifs encoded in this plasmid, can titrate the available concentration of the repressor at 28°C, explaining the effect observed. Further work to understand this intriguing and interesting regulatory mechanism is currently under way in our laboratory.
Figure 3:
Phaseolotoxin bioassay for P. syringae pv. phaseolicola NPS3121 harboring multiple copies of the interpromoter region. E. coli JM103 growth inhibition in minimal medium by added phaseolotoxin. Control; minimal medium with phaseolotoxin and supplemented with 10 mM arginine. On the left side of dishes, paper discs contain supernatant of cultures at 18°C; on right side, supernatant of cultures at 28°C.
Conclusions
This study revealed the importance of the interpromoter region to enhance the transcription of argK in P. syringae pv. phaseolicola. Additionally, this region in a multiple copies, interfered with the thermoregulation of phaseolotoxin at 28°C in strain NPS3121. Indeed, regulation of the phaseolotoxin biosynthesis is very complex and there are several unknown regulatory circuits that differentially affect the transcription of pht genes, including argK.
