Rosado-Flores, González-Prieto, Mireles-Martínez, Torres-Ortega, Rosas-García, and Villegas-Mendoza: Identificación de microorganismos aislados de suelos agrícolas con capacidad de tolerar 2.4-D y malatión



Introducción

La biorremediación es la eliminación, transformación o atenuación de xenobióticos mediante procesos biológicos llevados a cabo por organismos o los productos de estos (Shukla, Singh & Sharma, 2010; Adams, Fufeyin, Okoro & Ehinomen, 2015). Las técnicas de biorremediación pueden ser de dos tipos: la bioestimulación, donde se establecen las condiciones fisiológicas y de nutrición adecuadas, para inducir el crecimiento de los microorganismos nativos y la bioaumentación en la que se utilizan microorganismos específicos, cultivados previamente en presencia de contaminantes (Maheshwari et al., 2014).

Los microorganismos se caracterizan por ejercer una función importante en la degradación de xenobióticos, influir en los procesos físicos o químicos de la degradación y persistir a los compuestos recalcitrantes (Chakrabarty, 2017). Actualmente, las bacterias son las más estudiadas, debido a que cuentan con una extensa capacidad de adaptación (Biswas, 2015), son de crecimiento rápido y en general, más fáciles de cultivar en el laboratorio que otros microorganismos (Ortiz-Hernández, Sánchez-Salinas, Olvera-Velona & Folch-Mallol, 2011), como las siguientes: Flavobacterium sp., (Sethunathan & Yoshida, 1973), Sphingomomas sp., (Yao et al, 2015), Actinobacteria, Streptomyces sp., (Wang et al, 2017), Diferentes especies del género Bacillus (Ishag et al, 2017), Stenotrophomonas y Pseudomonas (Deng et al, 2015).

Los hongos, también presentan la capacidad de formar redes miceliales, además de usar el contaminante como sustrato de crecimiento y un sistema enzimático inespecífico, que los convierten en importantes herramientas biológicas para utilizar en la biorremediación (Harms, Schlosser & Wick, 2011). Como en Phanerochaete sordida (Mori et al., 2017) y los hongos ectomicorrícicos: Boletus edulis, Gomphidius viscidus, Laccaria bicolor, y Leccinum scabrum (Huang et al., 2007). El objetivo de este trabajo fue, a partir de suelos agrícolas mexicanos contaminados con agroquímicos, aislar e identificar microorganismos tolerantes a los plaguicidas, capacidad que los convierte en biodegradadores.

Materiales y métodos

Muestreo de suelo agrícola

Se obtuvieron muestras de los estados de Tamaulipas y Guanajuato, del primero en la localidad de la Estación Cuauhtémoc [22° 20’ y 22° 49’ N; 98° 21’y 97° 50’ O; entre 50 y 300 msnm] y en el municipio de Río Bravo [26° 05’ y 25° 23’ N; 98° 11’y 97° 51’ O; entre 50 y 500 msnm] y del segundo en los límites de Dolores Hidalgo [21° 21’ y 20° 51’ N; 100° 38’ y 101°13’O, entre 1,800 y 2, 800 msnm]. Las muestras se tomaron dentro de una parcela, en donde a partir de su centro y hacia el perímetro se eligieron al azar diez sitios en los que de cada uno, y a una profundidad de 10 cm, se extrajo 1 Kg de tierra, completando un total de 10 Kg que se secaron a temperatura ambiente durante 24 h, posteriormente se tamizaron en una malla del número 2 con una apertura de 20 mm, para obtener una muestra fina y homogénea. Las muestras se almacenaron en bolsas estériles a 4 °C.

Criterio de selección para la concentración Las concentraciones de 2,4 D y Malatión en la primera preselección son las mínimas reportadas para cada plaguicida en la literatura y en la segunda pre-selección se utilizaron las concentraciones máximas reportadas tanto para bacterias como hongos. (Tabla I)

Tabla I

Concentraciones ensayadas en bacterias y hongos de los plaguicidas seleccionados.

Plaguicida Concentración mínima Concentración máxima en bacterias Concentración máxima en hongos
2, 4- diclorofenoxiacético (2,4-D) 100 mg L-1 2500 mg L-1 2500 mg L-1
Malatión 50 mg L-1 500 mg L-1 400 mg L-1

Cultivo preselectivo de bacterias

La primer pre-selección se realizó en matraces de 250 mL, que contenían 100 mL de medio mínimo (MM), adicionado con 10 g de tierra seca tamizada, y como única fuente de carbono se agregó la concentración mínima del plaguicida; para inhibir el crecimiento fúngico se añadió 9.4 µl L-1 de carboxina [16 μM], incubándose durante 48 h a 37 °C y 170 rpm (Thermo Scientific, 435, MAXQ 480R HP). El control positivo consistió en un matraz sin plaguicida, con 1 g de glucosa como fuente de carbono y un control negativo sin glucosa. Transcurrido el periodo de incubación, se separó la fase acuosa del sedimento, filtrando el tratamiento con ayuda de un papel filtro de 10 x 10 cm y un embudo estéril, el sobrenadante se almacenó a 4°C hasta su uso.

En la segunda preselección se utilizaron tubos Falcón estériles de 50 mL, a los que se añadieron 20 mL de medio mínimo (MM), 1 mL del filtrado obtenido y las concentraciones máximas reportadas de los plaguicidas; con las mismas condiciones de incubación ya mencionadas. Al término del periodo de incubación se realizaron diluciones seriadas con agua estéril (10-1 a 10-4) de cada una de las concentraciones. Después se inocularon 500 μL (de cada dilución) en el centro de una caja de Petri de 100 x 15 mm con Agar y Medio Mínimo (adicionado con la concentración del plaguicida correspondiente, el inóculo se distribuyó en toda la superficie del agar con perlas de vidrio estériles y se incubó durante 24 h a 37°C, o hasta observar el crecimiento bacteriano (CO2 Incubator, Shel LAB). Después se aislaron las bacterias tomando una porción de la colonia con un asa bacteriológica estéril y se sembró mediante estriado cruzado en cajas de Petri de 100 x 15 con Agar Nutritivo (AN) (adicionado con 9.4 µl L-1 de carboxina) marca MCD LAB., incubándose durante 12 h a 37 °C. Las cajas se almacenaron a 4 °C hasta su uso.

Cultivo preselectivo de hongos

El cultivo de hongos es el mismo que para las bacterias con las siguientes variables: el periodo de incubación fue de 72 h a 28 °C y 250 rpm, para la inhibición de las bacterias se adicionó 1 µL mL-1 de ampicilina [100 µg mL-1]. En la segunda preselección para la incubación de las colonias también se utilizaron cajas Petri (100 x 15 mm) en un período que puede variar hasta observar el crecimiento fúngico de 4 días a 28 °C. El aislamiento de los hongos se realizó con un palillo estéril tomando una porción del micelio que se colocó, por picadura, en el centro del Agar Papa Dextrosa (PDA) marca MCD LAB, contenido en una caja Petri de (100 x 15mm), para incubación durante 72 h a 28 °C.

Morfología de los microorganismos aislados

La identificación de las colonias bacterianas se realizó utilizando el manual Bergey’s of Systematic Bacteriology (Brenner et al, 2005), posteriormente en un portaobjetos se fijaron por calor y tiñeron utilizando la tinción de Gram para observarlas con un microscopio óptico tri ocular (Leica DM750, Leica ICC50 HD) utilizando el objetivo 100 X (objetivo de inmersión) empleando el Software Las EZ v. 3.0.0 Copyright© 2013 Leica Microsystems. Las colonias bacterianas se agruparon de acuerdo con sus diferencias fenotípicas y su morfología celular.

Para la identificación macro-morfológica fúngica se realizaron cultivos monospóricos; tomando en cuenta las características fenotípicas presentadas en el anverso (tamaño, color y forma) y reverso (pigmento) de la colonia. La micro-morfología (tipo de micelio y espora, modalidad de micelio, morfología de esporas, forma de vesícula y conidios) se identificó realizando la técnica de microcultivo. El montaje se visualizó en un microscopio óptico tri ocular usando los objetivos 40 X y 100 X.

Identificación molecular

Para la identificación de las cepas bacterianas, se realizó la extracción de DNAg mediante el protocolo comercial de Wizard® Genomic DNA Purification Kit (Promega, A1120), de acuerdo a las instrucciones del fabricante. Posteriormente, se amplificó el gen 16S rDNA usando los oligonucleótidos universales dD1 (5’- AGAGTTTGATCCTGGCTCAG -3’) y rP2 (5’- ACGGCTACCTTGTTACGACTT -3´) diseñados por Weisburg (1991) y sintetizados por Biosynthesis (Lewisville, Tx). La reacción de amplificación contenía 12.5 µl de PCR PCRGoTaq® Master Mix 2 X (Promega ™), 1 µL de cada oligonucleótido (5 µM) y 1 μL de DNAg (50 ng) en un volumen final de 25 µL. Las condiciones de PCR usadas fueron un alineamiento a 94 °C/5 min; seguido de 35 ciclos de 94 °C/85 s, 58 °C/90 s, 72 °C/60 s; una extensión final a 72 °C/7 min. Después del gel de electroforesis, el producto de PCR fue purificado con ExoSAP-IT Clean up (Affly metrix, Inc) y cuantificado. Posteriormente fue enviado a Eurofins Genomics (EUA) de acuerdo a las instrucciones del proveedor. Las secuencias obtenidas fueron analizadas en el GenBank usando la base de datos BLAST.

Para la extracción de DNAg fúngico, se utilizó el método de cloroformo:octanol (24:1) de Reader & Broda (1985). Para ello se partió de 1 mL de cultivo de 48 h de crecimiento, al finalizar el DNA obtenido se cuantificó por Nano Drop, después, se amplificó la región ITS, utilizado los oligonucleótidos universales ITS1 (5’- TCCGTAGGTGAACCTGCGG -3’) e ITS4 (5’- TCCTCCGCTTATTGATATGC - 27 3’) (White, Bruns, Lee & Taylor, 1990) sintetizados por Biosynthesis (Lewisville, Tx). La reacción de amplificación fue la misma que en el protocolo anterior. Las condiciones de PCR usadas fueron un alineamiento a 94 °C/5 min; 35 ciclos de 94 °C/30 s, 58 °C/30 s, 72 °C/60 s; una extensión final a 72 °C/7 min. Después del gel de electroforesis el producto fue purificado, secuenciado y analizado de acuerdo al protocolo anterior.

Pruebas de tolerancia en bacterias

En tubos de fondo plano (2.3 x 9.5 cm), se añadieron 15 mL de caldo nutritivo y se adicionaron las concentraciones de los plaguicidas y el inóculo (1x108 células mL-1); se incubó durante 24 h a 37 ° y 170 rpm. Las concentraciones utilizadas para el herbicida 2,4-D fueron de 1.0; 1.25; 1.50; 1.75; 2.0; 2.5; 3.0 y 3.5 g L-1. Para el insecticida malatión se utilizaron concentraciones a partir de 0.5; 0.10; 0.15; 0.20; 0.25; 0.50; 1.0; 1.25; 1.50 y 2.0 g L-1. La tolerancia se midió con base en la concentración celular (crecimiento microbiológico), el cual se determinó por las variantes de densidad óptica (DO), la lectura se analizó en un espectrofotómetro (Cintra 10e, UVVisible Spectrometer, GBC), utilizando el Software Cintral v 2.4 a una longitud de onda de 625 nm. El control negativo se efectuó en un medio enriquecido sin inóculo ni plaguicida, para el control positivo se utilizó el mismo medio inoculado con el microorganismo, sin plaguicida. Los intervalos de medición establecidos incluían la medición inicial (0 h) y a las 24 h posteriores a la inoculación todos los tratamientos se efectuaron por triplicado.

Pruebas de tolerancia en hongos

Estas pruebas, se ejecutaron bajo el mismo procedimiento que en las pruebas de tolerancia bacterianas, modificando el medio a caldo papa dextrosa y el periodo de incubación de 72 h a 28 °C, 250 rpm. Las concentraciones para el herbicida 2,4-D se establecieron dentro de un intervalo de 0.03; 0.06; 0.12; 0.25; 0.50; 1.0 y 2.5 g L-1 y para el insecticida malatión se realizaron concentraciones de 0.01; 0.03; 0.06; 0.12; 0.25; 0.50; 1.0; 1.5; 2.0; 2.5; 2.7 y 3.0 g L-1. Los intervalos de medición se establecieron a las 0, 24, 48 y 72 h posteriores a la inoculación.

Análisis estadístico

Para determinar la tolerancia de los microorganismos a los Los microorganismos que crecieron en las concentraciones más altas de los plaguicidas, evaluados, 2,4-D y malatión, se infirieron como tolerantes. Las bacterias Acinetobacter lactucae, Pseudomonas aeruginosa y Stenotrophomonas pavanii mostraron la mayor tolerancia al herbicida 2,4-D a una concentración >2.0 g L-1 y >1.0 g L-1 al insecticida malatión, con excepción de la bacteria A. lactucae que, con plaguicidas se utilizó el programa estadístico IBM SPSS Statistics versión 22 utilizando el análisis de regresión, ejecutando el modelo Probit con prueba de significancia estadística P > 0.05.

Resultados

Se aislaron 68 bacterias y 6 hongos de la localidad Estación Cuauhtémoc, mientras que en la de Río Bravo fueron 90 bacterias y 12 hongos, por último del estado de Guanajuato se aislaron 120 bacterias y 3 hongos. Para la identificación molecular de las 278 bacterias se agruparon según su similitud morfológica y de esos grupos se escogieron 18 aislados representativos. En lo que concierne a los 21 hongos se seleccionaron 16 aislados representativos (Tabla II).

Tabla II

Selección de aislados bacterianos y fúngicos.

Claves Bacterias Hongos
B = Bacteria
H = Hongo
D= 2.3
Ma = Malatión
E= Estación Cuauhtémoc
R = Río Bravo
G = Guanajuato
# = Número de aislado
BDE13
BMaE2
BMaE1
BDR22
BDR11
BDR28
BMaR1
BMaR3
BMaR5
BMaR16
BDG15
BDG18
BDG17
BDG8
BDG36
BDG35
BMaG1
BMaG3
HDR1
HMaG4
HMaR7
HDE1
HDE5
HMaR8
HMaR4
HDG2
HDG6
HMaE1
HMaE2
HMaE3
HMaR2
HMaR5
HMaR6
HMaE8

En el análisis molecular de los aislados de bacterias se identificaron: Pseudomonas plecoglossicida, Acinetobacter lactucae, Pseudomonas aeruginosa, Acinetobacter pittii y Stenotrophomonas pavanii (Tabla III).

Tabla III

Análisis molecular de los aislados bacterianos.

Clave Cepa % identidad Número de acceso
BDE13 Pseudomonas aeruginosa cepa DSM 50071 98.50 NR_117678.1
BDR11 Acinetobacter lactucae cepa NRRL B-41902 99.86 NR_152004.1
BDR22 Acinetobacter pittii DSM 21653 cepa ATCC 19004 96.08 NR_117621.1
BDR28 Acinetobacter pittii DSM 21653 cepa ATCC 19004 99.79 NR_117621.1
BDG8 Pseudomonas plecoglossicida cepa NBRC 103162 99.64 NR_114226.1
BDG15 Pseudomonas plecoglossicida cepa NBRC 103162 99.64 NR_114226.1
BDG17 Pseudomonas plecoglossicida cepa NBRC 103162 99.19 NR_114226.1
BDG35 Acinetobacter lactucae cepa NRRL B-41902 99.01 NR_152004.1
BMaE1 Atlantibacter hermannii cepa CIP 103176 (Escherichia hermannii) 97.88 NR_104940.1
BMaE2 Acinetobacter pittii DSM 21653 cepa ATCC 19004 99.36 NR_117621.1
BMaR1 Pseudomonas aeruginosa cepa DSM 50071 99.06 NR_117678.1
BMaR3 Stenotrophomonas pavanii cepa LMG 25348 99.50 NR_118008.1
BMaR5 Pseudomonas plecoglossicida cepa NBRC 103162 99.22 NR_114226.1
BMaR16 Pseudomonas plecoglossicida cepa NBRC 103162 99.00 NR_114226.1
BMaG1 Pseudomonas aeruginosa cepa DSM 50071 98.13 NR_117678.1
BMaG3 Pseudomonas plecoglossicida cepa NBRC 103162 99.64 NR_114226.1

Para el caso de los hongos se identificaron los géneros Penicillium, Talaromyces, Aspergillus, Fusarium, Cladosporium y Rasamsonia. (Tabla IV).

Tabla IV

Análisis molecular de los aislados fúngicos.

Clave Cepa % Identidad Número de acceso
HDE1 Aspergillus sp. isolate FS-1 98.61 MK817589.1
HDE5 Talaromyces variabilis strain NRRL2125 61.
(Penicillium variabile)
98.02 KF984797.1
HMaE1 Cladosporium sp. aislado UoMD16-15 99.57 MF967429.1
HMaE2 Penicillium citrinum strain PcN25A01 99.34 MK852473.1
HMaE3 Aspergillus ustus cepa NRRL 1974 99.45 AY373879.1
HDR1 Fusarium sp. Isolate DS921 99.14 MK809003.1
HMaR7 Penicillium citrinum strain PcN25A01 99.77 MK852473.1
HMaR8 Penicillium citrinum strain PcN25A01 99.55 MK852473.1
HMaR4 Talaromyces variabilis strain NRRL2125 99.03 KF984797.1
HMaR2 Penicillium singorense isolate ST016 99.38 MK116430.1
HMaR5 Penicillium sp. isolate FL-18 100 MK817632.1
HMaR6 Penicillium sp. strain RRA89 99.59 KX953540.1
HDG2 Penicillium citrinum strain PcN25A01 96.90 MK852473.1
HDG6 Talaromyce sflavus strain Z2 100 MK271294.1
HMaG4 Penicillium citrinum strain PcN25A01 94.46 MK852473.1

Los microorganismos que crecieron en las concentraciones más altas de los plaguicidas, evaluados, 2,4-D y malatión, se infirieron como tolerantes. Las bacterias Acinetobacter lactucae, Pseudomonas aeruginosa y Stenotrophomonas pavanii mostraron la mayor tolerancia al herbicida 2,4-D a una concentración >2.0 g L-1 y >1.0 g L-1 al insecticida malatión, con excepción de la bacteria A. lactucae que, coneste último plaguicida fue ligeramente menor en comparación con las concentraciones toleradas por Acinetobacter pittii (Tabla V).

Tabla V

Tolerancia en bacterias.

Bacteria DL50
2,4-Dgr/l
DL50
malatión gr/l
Acinetobacter lactucae 2.084 1.069
Acinetobacter pittii 1.702 1.084
Atlantibacter hermannii 0.841 0.888
Pseudomonas aeruginosa 2.978 1.315
Pseudomonas plecoglossicida 1.438 1.007
Stenotrophomonas pavanii 2.462 1.200

De acuerdo con el análisis estadístico, la mayor tolerancia en los hongos se <observó en Fusarium sp., que creció a una concentración > 0.9 g L-1 con el herbicida 2,4-D y > 2.0 g L-1 con el insecticida malatión, para este último compuesto T. variabilis toleró >3.0 g L-1 (Tabla VI).

Tabla VI

Tolerancia en hongos.

Hongo DL50
2,4-Dgr/l
DL50
malatióngr/l
Aspergillus oryzae 0.154 0.016
Fusarium sudanense 0.904 2.072
Penicillium griseofulvum 0.234 0.108
Rasamsonia sp. 0.392 0.184
Talaromyces variabilis 0.320 3.172

Discusión

Las técnicas de biorremediación son importantes para desintoxicar sitios contaminados por xenobióticos recalcitrantes, como algunos agroquímicos. En este trabajo, los plaguicidas 2,4-D y malatión, fueron seleccionados por su amplia aplicación en los suelos de las regiones agrícolas muestreadas, además, son considerados tóxicos para el ser humano. Asimismo, en los microorganismos identificados se evaluó la tolerancia a esos plaguicidas. La bacteria Pseudomonas aeruginosa se eligió como tolerante, ya que mostró crecimiento a las concentraciones más altas evaluadas en este estudio, que fueron de 2.9 y 1.3 g L-1 de 2,4-D y malatión, respectivamente. Shafiani & Malik (2003), aislaron e identificaron al género Pseudomonas a partir de suelo agrícola, la bacteria se consideró como tolerante al plaguicida malatión a una concentración de 1,600 µg mL-1. Estudios realizados por Abo-Amer (2007), reportaron que P. aeruginosa presentó la capacidad de degradar 42.5 mg L-1 del insecticida malatión en un medio adicionado con peptona y extracto de levadura, el compuesto actúa como fuente secundaria de carbono, así como Saafan, Azmy, Amin, Ahmed & Essam (2016), registraron hallazgos similares con esta bacteria, la cual mostró el potencial de degradar hasta el 89% del malatión a partir de 100 mg L-1 adicionado con extracto de levadura y glucosa con los que visualizaron un aumento en la biomasa microbiana.

Por otra parte, la bacteria Stenotrophomonas pavanii creció a una concentración de 2.5 g L-1 del herbicida 2,4-D y 1.2 g L-1 del insecticida malatión, por lo que se seleccionó como tolerante. Sin embargo, S. pavanii no ha sido reportada en la tolerancia o degradación a los plaguicidas evaluados en este estudio. No obstante, Feng et al., (2017), reportaron a esta especie con la capacidad de degradar el insecticida organofosforado clorpirifos, utilizado como única fuente de carbono, la bacteria degradó el 90% del compuesto a partir de una concentración de 5 mg L-1. Además, algunos autores han registrado a especies del género Stenotrophomonas con la capacidad de degradar plaguicidas como el DDT, clorpirifos, fenvalerato, paratión, paraoxón, diazinón y foxim (Chen, Yang, Hu & Liu, 2011; Dubey & Fulekar, 2012; Deng et al, 2015; Barragan-Huerta et al, 2007).

La bacteria Acinetobacter lactucae, igualmente se seleccionó como tolerante debido a que creció a una concentración de 2.0 y 1.0, g L-1 del 2,4-D y malatión, respectivamente. Cabe mencionar que esa bacteria no ha sido estudiada en la degradación de los plaguicidas 2,4-D y malatión. Sin embargo, el género Acinetobacter ha sido reportado con la capacidad de degradar al plaguicida atrazina en medio mínimo, utilizado como la única fuente de carbono (Mirgain, Green & Monteil, 1993; Singh, Suri & Cameotra, 2004).

Por otra parte, en el hongo Cladosporium sp., no se logró medir la tolerancia mediante métodos turbidimétricos, debido al tipo de desarrollo que presentó, por lo que, es viable realizar la evaluación utilizando una metodología diferente como lo es la medición del crecimiento radial de la colonia (Arshad & Aishatul, 2015). El hongo Fusarium sp., se eligió como tolerante por presentar un crecimiento en concentraciones de 0.9 y 2.0 g L-1 del 2,4-D y malatión, respectivamente. Peter, Gajendiran, Mani, Nagaraj & Abraham (2015), registraron a la especie Fusarium oxysporum con la capacidad de degradar completamente al plaguicida malatión a una concentración de 400 mg L-1, este fue adicionado como única fuente de carbono en medio mínimo. Asimismo, este género se ha registrado con la capacidad de degradar otro tipo de compuestos como el poli succinato de butileno (PBS) (Mao, Liu, Gao, Su & Wang, 2015) e hidrocarburos aromáticos policíclicos (PAHs) (Potin, Rafin & Veignie, 2004; Wei et al, 2017). El hongo Talaromyces variabilis se seleccionó como tolerante únicamente al plaguicida malatión, porque creció a una concentración de 3.0 g L-1. Sin embargo, esta especie no ha sido reportada en la tolerancia o degradación de los plaguicidas evaluados en el presente trabajo. El género Talaromyces se ha caracterizado por incluir especies resistentes al calor (Yamashita, Nakagawa, Sakaguchi, Arima & Kikoku, 2018) de procesos industriales como la pasteurización, que impacta significativamente a diversos tipos de alimentos (Panek & Frąc, 2018).

Las bacterias Acinetobacter pitii, Atlantibacter hermanii y Pseudomonas plecoglossicida presentaron un crecimiento < 2.0 g L-1 con el herbicida 2,4-D e igual o < 1.0 g L-1 con el insecticida malatión, por lo que no se consideraron como tolerantes ni los hongos Aspergillus sp., Penicillium citrinum y Rasamsonia sp., debido a que mostraron un crecimiento a una concentración < 0.4 g L-1 en ambos plaguicidas. De los microorganismos mencionados Aspergillus sp., se ha utilizado en evaluaciones de degradación de los plaguicidas arbendazim, captan, mancozeb, metalaxil, tiram y carbofuran (Arshad & Aishatul, 2015). En el presente trabajo, las bacterias seleccionadas como tolerantes crecieron en concentraciones más altas del plaguicida 2,4-D (2.978 g L-1) en comparación a las evaluadas en los hongos (0.9 g L-1). Lo anterior podría suceder debido a que las bacterias usan al plaguicida como fuente de nutrientes y por ello logran tolerar concentraciones más altas (Mohiddin & Khan, 2013), en contraste con los hongos, en los que el plaguicida o sus metabolitos podrían permanecer en la biomasa sin presentar transformación (Botero, Mougin, Peñuela & Barriuso, 2017). La tolerancia a los plaguicidas se relaciona principalmente a la diversidad genética que codifica a enzimas especializadas en la degradación, esto se ve influenciado por los compuestos (Mousawi, 2005; Drouin, Sellami, Prevost, Fortin & Antoun, 2010), ya que un plaguicida induce a la formación de nuevas vías metabólicas en los microorganismos (Ahemad & Khan, 2011).

Además, hay autores que reportan especies bacterianas con la capacidad de degradar al herbicida 2,4-D en las que se incluyen a Flavobacterium sp. (Chaudhry & Huang, 1988), Achromobacter sp. (Xia et al., 2017), F. peregrinum, Arthrobacter sp. (Motosugi & Soda, 1983), Brevundimonas sp. (Smejkal, Seymour, Burton & Lappin-Scott, 2003) y especies fúngicas como Phanerochaete chrysosporium (Donnelly, Entry & Crawford, 1993; Yadav & Reddy, 1993), Paxillus involutus y Suillus variegatus (Meharg, Cairney & Maguire, 1997), Umbelopsis isabellina (Nykiel-Szymańska, Stolarek & Bernat, 2018). Por otro lado, las estrategias de biorremediación en México se han realizado con hongos del género Trichoderma, microorganismos nativos o consorcios para la degradación de plaguicidas como el DDT y sus metabolitos, el insecticida paratión, los herbicidas atrazina y 2,4-D. Lo anterior, se ha realizado en suelos bajo condiciones de laboratorio (Ortiz-Hernández, Monterrosas-Brisson, YanezOcampo & Sánchez-Salinas, 2001; Robles-González et al., 2006; Islas- Pelcastre et al., 2013; Ortiz, Velasco, Le Borgne & Revah, 2013). Además, se han llevado a cabo estudios de biodegradación utilizando consorcios bacterianos, en los que se incluyen a las bacterias Stenotrophomonas malthophilia, Proteus vulgaris, Vibrio metschinkouii, Serratia ficaria, Serratia sp. y Yersinia enterocolitica; estos fueron evaluados en la degradación de los insecticidas tetraclorvinfos y paratión (Ortiz-Hernández et al., 2001; Ortiz-Hernández & Sánchez-Salinas, 2010). A pesar de que en México no se han registrado estudios de biorremediación con la bacteria Acinetobacter lactucae, en el presente trabajo se evidenció su potencial capacidad para tolerar el insecticida malatión y por ésto sea posible su utilización en las técnicas de biorremediación de suelos.

Conclusiones

Las cepas con mas tolerancia a 2,4-D y malatión fueron Pseudomonas aeruginosa, Stenotrophomonas pavanii, Acinetobacter lactucae, Fusarium sp. y Talaromyces variabilis. Para el caso de S. pavanii, A. Lactucae y T. variabilis no existen reportes de tolerancia a los plaguicidas mencionados, sin embargo, en este trabajo se demuestra por primera vez que pueden ser utilizados en técnicas de biorremediación de suelos.

Agradecimientos

Al Instituto Politécnico Nacional y al laboratorio de biotecnología vegetal del Centro de Biotecnología Genómica.

Referencias

1 

Abo-Amer, A. (2007). Involvement of chromosomally-encoded genes in malathion utilization by Pseudomonas aeruginosa AA112. Acta microbiologica etimmunologica Hungarica, 54 (3), 261-277. DOI: 10.1556/AMicr.54.2007.3.3.

A. Abo-Amer 2007Involvement of chromosomally-encoded genes in malathion utilization by Pseudomonas aeruginosa AA112Acta microbiologica etimmunologica Hungarica54(326127710.1556/AMicr.54.2007.3.3.

2 

Adams, G. O., Fufeyin, P. T., Okoro, S. E., & Ehinomen, I. (2015). Bioremediation, biostimulation and bioaugmention: a review. International Journal of Environmental Bioremediation & Biodegradation, 3 (1): 28-39. DOI: 10.12691/ijebb-3-1-5.

G. O. Adams P. T. Fufeyin S. E. Okoro I. Ehinomen 2015Bioremediation, biostimulation and bioaugmention: a reviewInternational Journal of Environmental Bioremediation & Biodegradation3(1)283910.12691/ijebb-3-1-5.

3 

Ahemad, M. & Khan, M. S. (2011). Assessment of pesticidetolerance and functional diversity of bacterial strains isolated from rhizospheres of different crops. Insight Microbiol., 1, 8-19. DOI: 10.5567/IMICRO-IK.2011.8.19.

M. Ahemad M. S. Khan 2011Assessment of pesticidetolerance and functional diversity of bacterial strains isolated from rhizospheres of different cropsInsight Microbiol.181910.5567/IMICRO-IK.2011.8.19

4 

Arshad, A. M. & Aishatul, B. (2015). Aspergillus niger-a novel heavy metal bio-absorbent and pesticide tolerant fungus. Res. J. Chem. Environ., 19, 57-66.

A. M. Arshad B. Aishatul 2015Aspergillus niger-a novel heavy metal bio-absorbent and pesticide tolerant fungusRes. J. Chem. Environ.195766

5 

Barnes, N. M., Khodse, V. B., Lotlikar, N. P., Meena, R. M. & Damare, S. R. (2018). Bioremediation potential of hydrocarbon-utilizing fungi from select marine niches of India. 3 Biotech, 8, 1-21. DOI: 10.1007/s13205-017-1043-8.

N. M. Barnes V. B. Khodse N. P. Lotlikar R. M. Meena S. R. Damare 2018Bioremediation potential of hydrocarbon-utilizing fungi from select marine niches of India3 Biotech8,12110.1007/s13205-017-1043-8

6 

Barragán-Huerta, B. E., Costa-Pérez, C., Peralta-Cruz, J., Barrera-Cortés, J., Esparza-García, F. & RodríguezVázquez, R. (2007). Biodegradation of organochlorine pesticides by bacteria grown in microniches of the porous structure of green bean coffee. International Biodeterioration & Biodegradation, 59 (3), 239-244. DOI. 10.1016/j.ibiod.2006.11.001.

B. E. Barragán-Huerta C. Costa-Pérez J. Peralta-Cruz J. Barrera-Cortés F. Esparza-García R. RodríguezVázquez 2007Biodegradation of organochlorine pesticides by bacteria grown in microniches of the porous structure of green bean coffeeInternational Biodeterioration & Biodegradation59(3)23924410.1016/j.ibiod.2006.11.001

7 

Biswas, K. (2015). Biological agents of bioremediation: a concise review. Frontiers in Environmental Microbiology, 1 (3), 39-43. DOI: 10.11648/j.fem.20150103.11.

K. Biswas 2015Biological agents of bioremediation: a concise reviewFrontiers in Environmental Microbiology1(3)394310.11648/j.fem.20150103.11

8 

Botero, L. R., Mougin, C., Peñuela, G. & Barriuso, E. (2017). Formation of 2, 4-D bound residues in soils: New insights into microbial metabolism. Science of the Total Environment, 584, 715-722. DOI.org/10.1016/j.scitotenv.2017.01.105.

L. R. Botero C. Mougin G. Peñuela E. Barriuso 2017Formation of 2, 4-D bound residues in soils: New insights into microbial metabolismScience of the Total Environment58471572210.1016/j.scitotenv.2017.01.105

9 

Brenner, D. J., Krieg, N. R., Staley, J. T. & Garrity, G. M. (2005). Bergey’s Manual of Systematic Bacteriology, 2nd. 2.

D. J. Brenner N. R. Krieg J. T. Staley G. M. Garrity 2005Bergey’s Manual of Systematic Bacteriology2nd2

10 

Chakrabarty, A. M. (2017). Biodegradation and Detoxification of Environmental Pollutants. CRC Press. 31 p.

A. M. Chakrabarty 2017Biodegradation and Detoxification of Environmental PollutantsCRC Press31

11 

Chaudhry, G. R. & Huang, G. H. (1988). Isolation and characterization of a new plasmid from a Flavobacterium sp. which carries the genes for degradation of 2, 4-dichlorophenoxyacetate. Journal of bacteriology, 170 (9), 3897-3902. DOI: 10.1128/jb.170.9.3897-3902.1988.

G. R. Chaudhry G. H. Huang 1988Isolation and characterization of a new plasmid from a Flavobacterium sp. which carries the genes for degradation of 2, 4-dichlorophenoxyacetateJournal of bacteriology170(9)3897390210.1128/jb.170.9.3897-3902.1988

12 

Chen, S., Yang, L., Hu, M. & Liu, J. (2011). Biodegradation of fenvalerate and 3-phenoxybenzoic acid by a novel Stenotrophomonas sp. strain ZS-S-01 and its use in bioremediation of contaminated soils. Applied microbiology and biotechnology, 90 (2), 755-767. DOI: 10.1007/s00253010-3035-z.

S. Chen L. Yang M. Hu J. Liu 2011Biodegradation of fenvalerate and 3-phenoxybenzoic acid by a novel Stenotrophomonas sp. strain ZS-S-01 and its use in bioremediation of contaminated soilsApplied microbiology and biotechnology90(2)75576710.1007/s00253010-3035-z

13 

Deng, S., Chen, Y., Wang, D., Shi, T., Wu, X., Ma, X. & Li, Q. X. (2015). Rapid biodegradation of organophosphorus pesticides by Stenotrophomonas sp. G1. Journal of hazardous materials, 297, 17-24. DOI: 10.1016/j.jhazmat.2015.04.052.

S. Deng Y. Chen D. Wang T. Shi X. Wu X. Ma Q. X. Li 2015Rapid biodegradation of organophosphorus pesticides by Stenotrophomonas sp. G1Journal of hazardous materials297172410.1016/j.jhazmat.2015.04.052

14 

Donnelly, P. K., Entry, J. A. & Crawford, D. L. (1993). Degradation of atrazine and 2, 4-dichlorophenoxyacetic acid by mycorrhizal fungi at three nitrogen concentrations in vitro. Appl. Environ. Microbiol., 59 (8), 2642-2647. DOI: 10.1080/03601230701735227.

P. K. Donnelly J. A. Entry D. L. Crawford 1993Degradation of atrazine and 2, 4-dichlorophenoxyacetic acid by mycorrhizal fungi at three nitrogen concentrations in vitroAppl. Environ. Microbiol.59(8)2642264710.1080/03601230701735227

15 

Drouin, P., Sellami, M., Prevost, D., Fortin, J. & Antoun, H. (2010). Tolerance to agricultural pesticides of strains belonging to four genera of Rhizobiaceae. Journal of Environmental Science and Health Part B, 45 (8), 757-765. DOI. 10.1080/03601234.2010.515168.

P. Drouin M. Sellami D. Prevost J. Fortin H. Antoun 2010Tolerance to agricultural pesticides of strains belonging to four genera of RhizobiaceaeJournal of Environmental Science and Health Part B45(8)75776510.1080/03601234.2010.515168

16 

Dubey, K. K. & Fulekar, M. H. (2012). Chlorpyrifos bioremediation in Pennisetum rhizosphere by a novel potential degrader Stenotrophomonas maltophilia MHF ENV20. World Journal of Microbiology and Biotechnology, 28 (4), 1715-1725. DOI: 10.1007/s11274011-0982-1.

K. K. Dubey M. H. Fulekar 2012Chlorpyrifos bioremediation in Pennisetum rhizosphere by a novel potential degrader Stenotrophomonas maltophilia MHF ENV20World Journal of Microbiology and Biotechnology28(4)1715172510.1007/s11274011-0982-1.

17 

Feng, F., Ge, J., Li, Y., He, S., Zhong, J., Liu, X. & Yu, X. (2017). Enhanced degradation of chlorpyrifos in rice (Oryza sativa L.) by five strains of endophytic bacteria and their plant growth promotional ability. Chemosphere, 184, 505-513. DOI: 10.1016/j.chemosphere.2017.05.178.

F. Feng J. Ge Y. Li S. He J. Zhong X. Liu X. Yu 2017Enhanced degradation of chlorpyrifos in rice (Oryza sativa L.) by five strains of endophytic bacteria and their plant growth promotional abilityChemosphere18450551310.1016/j.chemosphere.2017.05.178

18 

Harms, H., Schlosser, D. & Wick, L. Y. (2011). Untapped potential: exploiting fungi in bioremediation of hazardous chemicals. Nature Reviews Microbiology, 9 (3), 177. DOI:10.1038/nrmicro2519.

H. Harms D. Schlosser L. Y. Wick 2011Untapped potential: exploiting fungi in bioremediation of hazardous chemicalsNature Reviews Microbiology9(3)1771770.1038/nrmicro2519

19 

Huang, Y., Zhao, X., & Luan, S. (2007). Uptake and biodegradation of DDT by 4 ectomycorrhizal fungi. Science of the Total Environment , 385 (1-3): 235-241. DOI: 10.1016/j.scitotenv.2007.04.023.

Y. Huang X. Zhao S. Luan 2007Uptake and biodegradation of DDT by 4 ectomycorrhizal fungiScience of the Total Environment385(1-3)23524110.1016/j.scitotenv.2007.04.023

20 

Ishag, A. E. S. A., Abdelbagi, A. O., Hammad, A. M. A., Elsheikh, E. A. E., Elsaid, O. E. & Hur, J. H. (2017). Biodegradation of endosulfan and pendimethalin by three strains of bacteria isolated from pesticides-polluted soils in the Sudan. Applied Biological Chemistry, 60 (3), 287-297. DOI.org/10.1007/ s13765-017-0281-0.

A. E. S. A. Ishag A. O. Abdelbagi A. M. A. Hammad E. A. E. Elsheikh O. E. Elsaid J. H. Hur 2017Biodegradation of endosulfan and pendimethalin by three strains of bacteria isolated from pesticides-polluted soils in the SudanApplied Biological Chemistry60(3)28729710.1007/ s13765-017-0281-0

21 

Islas-Pelcastre, M., Villagómez-Ibarra, J. R., Madariaga-Navarrete, A., Castros-Rosas, J., González-Ramírez, C. A. & Acevedo-Sandoval, O. A. (2013). Bioremediation perspectives using autochthonous speceies of Trichoderma sp. For degradation of atrazine in agricultural soil from the Tulancingo Valley, Hidalgo, Mexico. Tropical and Subtropical Agroecosystems, 16(2). 265-276.

M. Islas-Pelcastre J. R. Villagómez-Ibarra A. Madariaga-Navarrete J. Castros-Rosas C. A. González-Ramírez O. A. Acevedo-Sandoval 2013Bioremediation perspectives using autochthonous speceies of Trichoderma sp. For degradation of atrazine in agricultural soil from the Tulancingo Valley, Hidalgo, MexicoTropical and Subtropical Agroecosystems16(2)265276

22 

Mao, H., Liu, H., Gao, Z., Su, T. & Wang, Z. (2015). Biodegradation of poly (butylene succinate) by Fusarium sp. FS1301 and purification and characterization of poly (butylene succinate) depolymerase. Polymer degradation and stability, 114, 1-7. DOI.org/10.1016/j.polymdegradstab.2015.01.025.

H. Mao H. Liu Z. Gao T. Su Z. Wang 2015Biodegradation of poly (butylene succinate) by Fusarium sp. FS1301 and purification and characterization of poly (butylene succinate) depolymerasePolymer degradation and stability1141710.1016/j.polymdegradstab.2015.01.025

23 

Maheshwari, R., Singh, U., Singh, P., Singh, N., Lal, B. & Rani, B. (2014). To decontaminate wastewater employing bioremediation technologies. Journal of Advanced Scientific Research, 5 (2): 7-15.

R. Maheshwari U. Singh P. Singh N. Singh B. Lal B. Rani 2014To decontaminate wastewater employing bioremediation technologiesJournal of Advanced Scientific Research5(2)715

24 

Meharg, A. A., Cairney, J. W. & Maguire, N. (1997). Mineralization of 2, 4-dichlorophenol by ectomycorrhizal fungi in axenic culture and in symbiosis with pine. Chemosphere , 34 (12), 2495-2504. DOI.org/10.1016/ S0045-6535(97)00005-2.

A. A. Meharg J. W. Cairney N. Maguire 1997Mineralization of 2, 4-dichlorophenol by ectomycorrhizal fungi in axenic culture and in symbiosis with pineChemosphere34(12)2495250410.1016/ S0045-6535(97)00005-2

25 

Mirgain, I., Green, G. A. & Monteil, H. (1993). Degradation of atrazine in laboratory microcosms: isolation and identification of the biodegrading bacteria. Environmental Toxicology and Chemistry: An International Journal, 12 (9), 1627-1634. DOI. 10.1002/etc.5620120911.

I. Mirgain G. A. Green H. Monteil 1993Degradation of atrazine in laboratory microcosms: isolation and identification of the biodegrading bacteriaEnvironmental Toxicology and Chemistry: An International Journal12(9)1627163410.1002/etc.5620120911

26 

Mohiddin, F. A. & Khan, M. R. (2013). Tolerance of fungal and bacterial biocontrol agents to six pesticides commonly used in the control of soil borne plant pathogens. African Journal of Agricultural, 8 (43), 5272-5275. DOI: 10.5897/AJAR11.677.

F. A. Mohiddin M. R. Khan 2013Tolerance of fungal and bacterial biocontrol agents to six pesticides commonly used in the control of soil borne plant pathogensAfrican Journal of Agricultural8(43)5272527510.5897/AJAR11.677

27 

Mori, T., Wang, J., Tanaka, Y., Nagai, K., Kawagishi, H. & Hirai, H. (2017). Bioremediation of the neonicotinoid insecticide clothianidin by the white-rot fungus Phanerochaete sordida. Journal of hazardous materials , 321, 586-590. DOI: 10.1016/j.jhazmat.2016.09.049.

T. Mori J. Wang Y. Tanaka K. Nagai H. Kawagishi H. Hirai 2017Bioremediation of the neonicotinoid insecticide clothianidin by the white-rot fungus Phanerochaete sordidaJournal of hazardous materials,32158659010.1016/j.jhazmat.2016.09.049

28 

Motosugi, K. & Soda, K. (1983). Microbial degradation of synthetic organochlorine compounds. Cellular and Molecular Life Sciences, 39 (11), 1214-1220. DOI: 10.1007/BF01990358.

K. Motosugi K. Soda 1983Microbial degradation of synthetic organochlorine compoundsCellular and Molecular Life Sciences39(11)1214122010.1007/BF01990358

29 

Mousawi, A. N. M. (2005). Study of bacterial resistance to organophosphorous pesticides in Iran. Journal of Environmental Health Science & Engineering, 2 (3), 207-211.

A. N. M. Mousawi 2005Study of bacterial resistance to organophosphorous pesticides in IranJournal of Environmental Health Science & Engineering2(3)207211

30 

Nykiel-Szymańska, J., Stolarek, P. & Bernat, P. (2018). Elimination and detoxification of 2, 4-D by Umbelopsis isabellina with the involvement of cytochrome P450. Environmental Science and Pollution Research, 25 (3), 2738-2743. DOI: 10.1007/s11356-017-0571-4.

J. Nykiel-Szymańska P. Stolarek P. Bernat 2018Elimination and detoxification of 2, 4-D by Umbelopsis isabellina with the involvement of cytochrome P450Environmental Science and Pollution Research25(3)2738274310.1007/s11356-017-0571-4

31 

Ortíz, I., Velasco, A., Le Borgne, S. & Revah, S. (2013). Biodegradation of DDT by stimulation of indigenous microbial populations in soil with cosubstrates. Biodegradation, 24 (2), 215-225. DOI: 10.1007/s10532012-9578-1.

I. Ortíz A. Velasco S. Le Borgne S. Revah 2013Biodegradation of DDT by stimulation of indigenous microbial populations in soil with cosubstratesBiodegradation24(2)21522510.1007/s10532012-9578-1

32 

Ortiz-Hernández, M. L., Monterrosas-Brisson, M., Yanez-Ocampo, G. & Sánchez-Salinas, E. (2001). Biodegradation of methyl-parathion by bacteria isolated of agricultural soil. Revista Internacional de Contaminación Ambiental, 17 (3), 147-155.

M. L. Ortiz-Hernández M. Monterrosas-Brisson G. Yanez-Ocampo E. Sánchez-Salinas 2001Biodegradation of methyl-parathion by bacteria isolated of agricultural soilRevista Internacional de Contaminación Ambiental17(3)147155

33 

Ortiz-Hernández, M. L., Sánchez-Salinas, E., Olvera-Velona, A. & Folch-Mallol, J. L. (2011). Pesticides in the environment: impacts and its biodegradation as a strategy for residues treatment. In Pesticides-formulations, effects, fate. Intech. Open, 551-574. DOI: 10.5772/1004.

M. L. Ortiz-Hernández E. Sánchez-Salinas A. Olvera-Velona J. L. Folch-Mallol 2011Pesticides in the environment: impacts and its biodegradation as a strategy for residues treatment. In Pesticides-formulations, effects, fateIntech. Open55157410.5772/1004

34 

Ortiz-Hernández, M. L. & Sánchez-Salinas, E. (2010). Biodegradation of the organophosphate pesticide tetrachlorvinphos by bacteria isolated from agricultural soils in México. Revista Internacional de Contaminación Ambiental , 26 (1), 27-38.

M. L. Ortiz-Hernández E. Sánchez-Salinas 2010Biodegradation of the organophosphate pesticide tetrachlorvinphos by bacteria isolated from agricultural soils in MéxicoRevista Internacional de Contaminación Ambiental26(1)2738

35 

Panek, J. & Frąc, M. (2018). Development of a qPCR assay for the detection of heat-resistant Talaromyce sflavus. International journal of food microbiology, 270, 44-51. DOI.org/ 10.1016/j.ijfoodmicro.2018.02.010.

J. Panek M. Frąc 2018Development of a qPCR assay for the detection of heat-resistant Talaromyce sflavusInternational journal of food microbiology270445110.1016/j.ijfoodmicro.2018.02.010

36 

Peter, L., Gajendiran, A., Mani, D., Nagaraj, S. & Abraham, J. (2015). Mineralization of malathion by Fusarium oxysporum strain JASA1 isolated from sugarcane fields. Environmental Progress & Sustainable Energy, 34 (1), 112-116. DOI: 10.1002/ep.11970.

L. Peter A. Gajendiran D. Mani S. Nagaraj J. Abraham 2015Mineralization of malathion by Fusarium oxysporum strain JASA1 isolated from sugarcane fieldsEnvironmental Progress & Sustainable Energy34(1)11211610.1002/ep.11970

37 

Potin, O., Rafin, C. & Veignie, E. (2004). Bioremediation of an aged polycyclic aromatic hydrocarbons (PAHs)contaminated soil by filamentous fungi isolated from the soil. International Biodeterioration & Biodegradation , 54 (1), 45-52. DOI: 10.1016/j.ibiod.2004.01.003.

O. Potin C. Rafin E. Veignie 2004Bioremediation of an aged polycyclic aromatic hydrocarbons (PAHs)contaminated soil by filamentous fungi isolated from the soilInternational Biodeterioration & Biodegradation54(1)455210.1016/j.ibiod.2004.01.003

38 

Reader, U. & Broda, P. (1985). Rapid preparation of DNA from filamentous fungi. Letter Applied Microbiology, 1, 17-20. DOI.org/10.1111/j.1472-765X.1985.tb01479.x.

U. Reader P. Broda 1985Rapid preparation of DNA from filamentous fungiLetter Applied Microbiology1,172010.1111/j.1472-765X.1985.tb01479.x

39 

Robles-González, I., Ríos-Leal, E., Ferrera-Cerrato, R., Esparza-García, F., Rinderkenecht-Seijas, N. & Poggi-Varaldo, H. M. (2006). Bioremediation of a mineral soil with high contents of clay and organic matter contaminated with herbicide 2, 4-dichlorophenoxyacetic acid using slurry bioreactors: effect of electron acceptor and supplementation with an organic carbon source. Process Biochemistry, 41 (9), 1951-1960. DOI.org/10.1016/j.procbio.2006.04.004.

I. Robles-González E. Ríos-Leal R. Ferrera-Cerrato F. Esparza-García N. Rinderkenecht-Seijas H. M. Poggi-Varaldo 2006Bioremediation of a mineral soil with high contents of clay and organic matter contaminated with herbicide 2, 4-dichlorophenoxyacetic acid using slurry bioreactors: effect of electron acceptor and supplementation with an organic carbon sourceProcess Biochemistry41(91951196010.1016/j.procbio.2006.04.004

40 

Saafan, A. E., Azmy, A. F., Amin, M. A., Ahmed, S. H. & Essam, T. M. (2016). Isolation and characterization of two malathion degrading Pseudomonas sp. in Egypt. African Journal of Biotechnology, 15 (31), 1661-1672. DOI: 10.5897/AJB2016.15273.

A. E. Saafan A. F. Azmy M. A. Amin S. H. Ahmed T. M. Essam 2016Isolation and characterization of two malathion degrading Pseudomonas sp. in EgyptAfrican Journal of Biotechnology15(31)1661167210.5897/AJB2016.15273

41 

Sethunathan, N. & Yoshida, T. (1973). A Flavobacterium sp. that degrades diazinonand parathion. Canadian Journal of Microbiology, 19 (7), 873-875. DOI: 10.1139/m73-138.

N. Sethunathan T. Yoshida 1973A Flavobacterium sp. that degrades diazinonand parathionCanadian Journal of Microbiology19(7)87387510.1139/m73-138

42 

Shafiani, S. & Malik, A. (2003). Tolerance of pesticides and antibiotic resistance in bacteria isolated from wastewater-irrigated soil. World Journal of Microbiology and Biotechnology , 19 (9), 897-901. DOI.org/10.1023/ B:WIBI.0000007290.94694.4f.

S. Shafiani A. Malik 2003Tolerance of pesticides and antibiotic resistance in bacteria isolated from wastewater-irrigated soilWorld Journal of Microbiology and Biotechnology19(9)89790110.1023/ B:WIBI.0000007290.94694.4f

43 

Shukla, K. P., Singh, N. K., & Sharma, S. (2010). Bioremediation: developments, current practices and perspectives. Genet. Eng. Biotechnol. J., 3: 1-20.

K. P. Shukla N. K. Singh S. Sharma 2010Bioremediation: developments, current practices and perspectivesGenet. Eng. Biotechnol. J.3120

44 

Singh, P., Suri, C. R. & Cameotra, S. S. (2004). Isolation of a member of Acinetobacter species involved in atrazine degradation. Biochemical and biophysical research communications, 317 (3), 697-702. DOI: 10.1016/j. bbrc.2004.03.112.

P. Singh C. R. Suri S. S. Cameotra 2004Isolation of a member of Acinetobacter species involved in atrazine degradationBiochemical and biophysical research communications317(3)69770210.1016/j. bbrc.2004.03.112

45 

Smejkal, C. W., Seymour, F. A., Burton, S. K. & Lappin-Scott, H. M. (2003). Characterization of bacterial cultures enriched on the chlorophenoxyalkanoic acid herbicides 4-(2, 4-dichlorophenoxy) butyric acid and 4-(4-chloro2-methylphenoxy) butyric acid. Journal of Industrial Microbiology and Biotechnology, 30 (9), 561-567. DOI: 10.1007/s10295-003-0086-5.

C. W. Smejkal F. A. Seymour S. K. Burton H. M. Lappin-Scott 2003Characterization of bacterial cultures enriched on the chlorophenoxyalkanoic acid herbicides 4-(2, 4-dichlorophenoxy) butyric acid and 4-(4-chloro2-methylphenoxy) butyric acidJournal of Industrial Microbiology and Biotechnology30(9)56156710.1007/s10295-003-0086-5

46 

Wang, B., Liu, W., Liu, X., Franks, A. E., Teng, Y. & Luo, Y. (2017). Comparative analysis of microbial communities during enrichment and isolation of DDT-degrading bacteria by culture-dependent and-independent methods. Science of the Total Environment , 590, 297-303. DOI: 10.1016/j. scitotenv.2017.03.004.

B. Wang W. Liu X. Liu A. E. Franks Y. Teng Y. Luo 2017Comparative analysis of microbial communities during enrichment and isolation of DDT-degrading bacteria by culture-dependent and-independent methodsScience of the Total Environment59029730310.1016/j. scitotenv.2017.03.004

47 

Wei, S., Xue-na, Z., Hai-bin, J., Sheng-dong, F., Zhin-xin, Y., Ou-ya, Z., Yu-ling, L. (2017). Effective remediation of aged HMW-PAHs polluted agricultural soil by the combination of Fusarium sp. And smooth bromegrass (Bromus inermis leyss). Journal of integratiev agriculture, 16(1). 199-209. DOI: 10.1016/S2095-3119(16)61373-4.

S. Wei Z. Xue-na J. Hai-bin F. Sheng-dong Y. Zhin-xin Z. Ou-ya L. Yu-ling 2017Effective remediation of aged HMW-PAHs polluted agricultural soil by the combination of Fusarium sp. And smooth bromegrass (Bromus inermis leyss)Journal of integratiev agriculture16(1)19920910.1016/S2095-3119(16)61373-4

48 

Weisburg, W., Barns, S. M., Pelletier, D. A. & Lane, D. J. (1991). 16S Ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology, 173(2). 697-703. DOI: 10.1128/jb.173.2.697-703.1991.

W. Weisburg S. M. Barns D. A. Pelletier D. J. Lane 199116S Ribosomal DNA amplification for phylogenetic studyJournal of Bacteriology173(2)69770310.1128/jb.173.2.697-703.1991

49 

White, T. J., Bruns, T., Lee, S. & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, Academic Press, New York, 315-322. DOI: 10.1016/b978-0-12-372180-8.50042-1.

T. J. White T. Bruns S. Lee J. Taylor 1990Amplification and direct sequencing of fungal ribosomal RNA genes for phylogeneticsPCR Protocols: A Guide to Methods and ApplicationsAcademic PressNew York31532210.1016/b978-0-12-372180-8.50042-1

50 

Xia, Z. Y., Zhang, L., Zhao, Y., Yan, X., Li, S. P., Gu, T. & Jiang, J. D. (2017). Biodegradation of the herbicide 2, 4-dichlorophenoxyacetic acid by a new isolated strain of Achromobacter sp. LZ35. Current microbiology, 74 (2), 193-202. DOI: 10.1007/s00284-016-1173-y.

Z. Y. Xia L. Zhang Y. Zhao X. Yan S. P. Li T. Gu J. D. Jiang 2017Biodegradation of the herbicide 2, 4-dichlorophenoxyacetic acid by a new isolated strain of Achromobacter sp. LZ35Current microbiology74(2)19320210.1007/s00284-016-1173-y

51 

Yadav, J. S. & Reddy, C. A. (1993). Mineralization of 2, 4-dichlorophenoxyacetic acid (2, 4-D) and mixtures of 2, 4-D and 2, 4, 5-trichlorophenoxyacetic acid by Phanerochaete chrysosporium. Appl. Environ. Microbiol. , 59 (9), 2904-2908. DOI: 10.1128/AEM.59.9.2904-2908.1993.

J. S. Yadav C. A. Reddy 1993Mineralization of 2, 4-dichlorophenoxyacetic acid (2, 4-D) and mixtures of 2, 4-D and 2, 4, 5-trichlorophenoxyacetic acid by Phanerochaete chrysosporiumAppl. Environ. Microbiol.59(9)2904290810.1128/AEM.59.9.2904-2908.1993

52 

Yamashita, S., Nakagawa, H., Sakaguchi, T., Arima, T. H. & Kikoku, Y. (2018). Design of a species‐specific PCR method for the detection of the heat-resistant fungi Talaromyces macrospores and Talaromyces trachyspermus. Letters in applied microbiology, 66 (1), 86-92. DOI: 10.1111/ lam.12818.

S. Yamashita H. Nakagawa T. Sakaguchi T. H. Arima Y. Kikoku 2018Design of a species‐specific PCR method for the detection of the heat-resistant fungi Talaromyces macrospores and Talaromyces trachyspermusLetters in applied microbiology66(1)869210.1111/ lam.12818

53 

Yao, L., Jia, X., Zhao, J., Cao, Q., Xie, X., Yu, L. & Tao, Q. (2015). Degradation of the herbicide dicamba by two sphingomonads via different O-demethylation mechanisms. International Biodeterioration & Biodegradation , 104, 324-332. DOI.org/10.1016/j.ibiod.2015.06.016.

L. Yao X. Jia J. Zhao Q. Cao X. Xie L. Yu Q. Tao 2015Degradation of the herbicide dicamba by two sphingomonads via different O-demethylation mechanismsInternational Biodeterioration & Biodegradation10432433210.1016/j.ibiod.2015.06.016



This display is generated from NISO JATS XML with jats-html.xsl. The XSLT engine is libxslt.

Enlaces refback

  • No hay ningún enlace refback.


Financiado por:

 

Proyecto C-297282

Licencia Creative Commons
TIP Revista Especializada en Ciencias Químico-Biológicas está distribuido bajo una Licencia Creative Commons Atribución-NoComercial-SinDerivar 4.0 Internacional.

TIP REVISTA ESPECIALIZADA EN CIENCIAS QUÍMICO-BIOLÓGICAS, Volumen 24, 2021, es una publicación editada por la Universidad Nacional Autónoma de México, Ciudad Universitaria, Deleg. Coyoacán, C.P. 04510, Ciudad de México, México, a través de la Facultad de Estudios Superiores Zaragoza, Campus I, Av. Guelatao # 66, Col. Ejército de Oriente, Deleg. Iztapalapa, C.P. 09230, Ciudad de México, México, Teléfono: 55.56.23.05.27, http://tip.zaragoza.unam.mx, Correo electrónico revistatip@yahoo.com, Editor responsable: Dra. Martha Asunción Sánchez Rodríguez, Certificado de Reserva de Derechos al Uso Exclusivo del Título No. 04-2014-062612263300-203, ISSN impreso: 1405-888X, ISSN electrónico: 2395-8723, otorgados por el Instituto Nacional del Derecho de Autor, Responsable de la última actualización de este número Claudia Ahumada Ballesteros, Facultad de Estudios Superiores Zaragoza, Av. Guelatao # 66, Col. Ejército de Oriente, Deleg. Iztapalapa, C.P. 09230, Ciudad de México, México, fecha de la última modificación, 4 de febrero de 2021.

Esta página puede ser reproducida con fines no lucrativos, siempre y cuando no se mutile, se cite la fuente completa y su dirección electrónica. De otra forma requiere permiso previo de la institución.